helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Which of the following territories is INCORRECTLY matched with the nation that conquered or assumed control over it by the eve of World War II? a. Ethopia/Ital

Identify the framers of the constitution and describe, in general, their background and experiences?

solve h=-b/2a for b this is a algebra question

In My Bondage and My Freedom by Frederick Douglass, why does Mrs. Auld follow her husband’s advice to stop teaching Douglass to read? She was afraid of her husb

turn ten times the quotient of 104 and 8 into an expression

The smallest package weighed only 1/3 more than 1/2 the weight of the heaviest package. If the two packages combined weighed 100 kilograms, how much did the sma

What is the best way to lose 1 pound a. reduce carbohydrate intake by 3500 b. reduce carbohydrate intake by 7000 c. reduce caloriei intake by 3500 d. reduce cal

Describe Coffee's effect on the balance of power between various regions of the world.

Describe Coffee's effect on the balance of power between various regions of the world.

How many moles of cesium (Cs) atoms are in 675g Cs?