nvxa98a45k
nvxa98a45k nvxa98a45k
  • 26-02-2021
  • Biology
contestada

CAN someone please help thx!!

CAN someone please help thx class=

Respuesta :

memonmuqadas705
memonmuqadas705 memonmuqadas705
  • 08-03-2021

Answer:

I think.... option A is correct

Answer Link

Otras preguntas

which of the following most accurately summarizes the effects of mutations on living things A) most mutations are harmful, but some have little effect B) many m
x = a) 90 b) 135 c) 270
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
What would MOST LIKELY happen to the population of the water flea if the algae decreased?
Audrey went to the mall.she spent half of her money on a shirt. she spent $5.35 on lunch. she bought a pair of shoes for $21.39. She has $3.26 left. How much mo
Abe is giving his children some brain teaser challenges. he asked, "if a smot is bigger than a hek, a kom is bigger than duj, and a smot is bigger than a kom, t
which table represents a linear function
Cancer is marked by uncontrolled cell growth and division. Which factor in excessive amounts contributes to this development? signal molecules binary f
Do all markets function the same way around the world?
To convert 120 ounces to pounds, which of the following proportions should you use?